recombinant human interferon g (ifng (PeproTech)
PeproTech is a verified supplier 
90
Structured Review
PeproTech
recombinant human interferon g (ifng
Recombinant Human Interferon G (Ifng, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+interferon-g/recombinant+human+ifn+%CE%B3/pm39437716-177-17-22
Average 90 stars, based on 1 article reviews
Recombinant Human Interferon G (Ifng, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+interferon-g/recombinant+human+ifn+%CE%B3/pm39437716-177-17-22
Average 90 stars, based on 1 article reviews
recombinant human interferon g (ifng - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Western Blot:Article Title: Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer. Article Snippet: PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version www.pdflib.com – sales@pdflib.com T R A N S P L A N T A T I O N A N D C E L L U L A R E N G I N E E R I N G Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer Raffaella Giancola, Paola Olioso, Maria Di Riti, Anita Capone, Alessandro Contento, Franca Pompetti, and Antonio Iacone BACKGROUND: Cytokine-induced killer (CIK) cells are a heterogeneous population of immune cells derived from peripheral blood lymphocytes with a high proliferative potential ex vivo.. This study shows a rapid and reproducible protocol for adoptive immunotherapy with CIK cells in patients with hematologic malignancies.. For this purpose a new automatic cell processing device (CytoMate, Baxter Oncology) was tested to improve extensive manipulations of these cells. Article Title: Interferon-γ induces combined pyroptotic angiopathy and APOL1 expression in human kidney disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Liu et al. scRNAseq NIH GEO database GEO: GSE135663 Organoid scRNAseq NIH GEO database GEO: GSE230848 NEPTUNE bulk RNAseq NIH GEO database GEO: GSE219185 NEPTUNE snRNAseq NIH GEO database GEO: GSE213030 Experimental models: Cell lines WTC11 iPSCs derived from a Japanese male donor Coriell GM25256 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E8 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E9 GFP-Tubulin Allen Institute/Coriell AICS-0012 1016SevA iPSCs derived from fibroblasts from a non-African ancestry donor Harvard Stem Cell Institute N/A UM77-2 hESCs J Harder Lab, University of Michigan NIH registration no. 0278 iPSC line BXS0114 (African American Female) ATCC ACS-1028 iPSC line BYS0110 (African American Male) ATCC ACS-1024 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC35 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC36 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC37 HUVECs #1 (pooled donors, Lot #0000478982) Lonza CC-2519 HUVECs #2 (pooled donors, Lot #3001900190) Lonza CC-2519 HUVECs #3 (pooled donors, Lot #0000474578) Lonza CC-2519 Oligonucleotides CCACCGGCAGACCGGACTAG IDT HF22 Recombinant DNA pGuide (modified for oligo HF22) Addgene 64711 pCas9_GFP Addgene 44719 Software and algorithms ImageJ 1.54f NIH N/A R Software (R Core Team [2023]) N/A Seurat v4.0 N/A CZ CELLxGENE Chan Zuckerberg Initiative N/A Ingenuity Pathway Analysis (IPA) Qiagen N/A Recombinant:Article Title: Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer. Article Snippet: PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version www.pdflib.com – sales@pdflib.com T R A N S P L A N T A T I O N A N D C E L L U L A R E N G I N E E R I N G Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer Raffaella Giancola, Paola Olioso, Maria Di Riti, Anita Capone, Alessandro Contento, Franca Pompetti, and Antonio Iacone BACKGROUND: Cytokine-induced killer (CIK) cells are a heterogeneous population of immune cells derived from peripheral blood lymphocytes with a high proliferative potential ex vivo.. This study shows a rapid and reproducible protocol for adoptive immunotherapy with CIK cells in patients with hematologic malignancies.. For this purpose a new automatic cell processing device (CytoMate, Baxter Oncology) was tested to improve extensive manipulations of these cells. Article Title: Interferon-γ induces combined pyroptotic angiopathy and APOL1 expression in human kidney disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Liu et al. scRNAseq NIH GEO database GEO: GSE135663 Organoid scRNAseq NIH GEO database GEO: GSE230848 NEPTUNE bulk RNAseq NIH GEO database GEO: GSE219185 NEPTUNE snRNAseq NIH GEO database GEO: GSE213030 Experimental models: Cell lines WTC11 iPSCs derived from a Japanese male donor Coriell GM25256 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E8 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E9 GFP-Tubulin Allen Institute/Coriell AICS-0012 1016SevA iPSCs derived from fibroblasts from a non-African ancestry donor Harvard Stem Cell Institute N/A UM77-2 hESCs J Harder Lab, University of Michigan NIH registration no. 0278 iPSC line BXS0114 (African American Female) ATCC ACS-1028 iPSC line BYS0110 (African American Male) ATCC ACS-1024 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC35 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC36 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC37 HUVECs #1 (pooled donors, Lot #0000478982) Lonza CC-2519 HUVECs #2 (pooled donors, Lot #3001900190) Lonza CC-2519 HUVECs #3 (pooled donors, Lot #0000474578) Lonza CC-2519 Oligonucleotides CCACCGGCAGACCGGACTAG IDT HF22 Recombinant DNA pGuide (modified for oligo HF22) Addgene 64711 pCas9_GFP Addgene 44719 Software and algorithms ImageJ 1.54f NIH N/A R Software (R Core Team [2023]) N/A Seurat v4.0 N/A CZ CELLxGENE Chan Zuckerberg Initiative N/A Ingenuity Pathway Analysis (IPA) Qiagen N/A High Molecular Weight:Article Title: Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer. Article Snippet: PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version www.pdflib.com – sales@pdflib.com T R A N S P L A N T A T I O N A N D C E L L U L A R E N G I N E E R I N G Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer Raffaella Giancola, Paola Olioso, Maria Di Riti, Anita Capone, Alessandro Contento, Franca Pompetti, and Antonio Iacone BACKGROUND: Cytokine-induced killer (CIK) cells are a heterogeneous population of immune cells derived from peripheral blood lymphocytes with a high proliferative potential ex vivo.. This study shows a rapid and reproducible protocol for adoptive immunotherapy with CIK cells in patients with hematologic malignancies.. For this purpose a new automatic cell processing device (CytoMate, Baxter Oncology) was tested to improve extensive manipulations of these cells. Article Title: Interferon-γ induces combined pyroptotic angiopathy and APOL1 expression in human kidney disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Liu et al. scRNAseq NIH GEO database GEO: GSE135663 Organoid scRNAseq NIH GEO database GEO: GSE230848 NEPTUNE bulk RNAseq NIH GEO database GEO: GSE219185 NEPTUNE snRNAseq NIH GEO database GEO: GSE213030 Experimental models: Cell lines WTC11 iPSCs derived from a Japanese male donor Coriell GM25256 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E8 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E9 GFP-Tubulin Allen Institute/Coriell AICS-0012 1016SevA iPSCs derived from fibroblasts from a non-African ancestry donor Harvard Stem Cell Institute N/A UM77-2 hESCs J Harder Lab, University of Michigan NIH registration no. 0278 iPSC line BXS0114 (African American Female) ATCC ACS-1028 iPSC line BYS0110 (African American Male) ATCC ACS-1024 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC35 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC36 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC37 HUVECs #1 (pooled donors, Lot #0000478982) Lonza CC-2519 HUVECs #2 (pooled donors, Lot #3001900190) Lonza CC-2519 HUVECs #3 (pooled donors, Lot #0000474578) Lonza CC-2519 Oligonucleotides CCACCGGCAGACCGGACTAG IDT HF22 Recombinant DNA pGuide (modified for oligo HF22) Addgene 64711 pCas9_GFP Addgene 44719 Software and algorithms ImageJ 1.54f NIH N/A R Software (R Core Team [2023]) N/A Seurat v4.0 N/A CZ CELLxGENE Chan Zuckerberg Initiative N/A Ingenuity Pathway Analysis (IPA) Qiagen N/A Cell Culture:Article Title: Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer. Article Snippet: PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version www.pdflib.com – sales@pdflib.com T R A N S P L A N T A T I O N A N D C E L L U L A R E N G I N E E R I N G Evaluation of an automated closed fluid management device for processing expanded cytokine-induced killer cells to use in immunotherapy programs for cancer Raffaella Giancola, Paola Olioso, Maria Di Riti, Anita Capone, Alessandro Contento, Franca Pompetti, and Antonio Iacone BACKGROUND: Cytokine-induced killer (CIK) cells are a heterogeneous population of immune cells derived from peripheral blood lymphocytes with a high proliferative potential ex vivo.. This study shows a rapid and reproducible protocol for adoptive immunotherapy with CIK cells in patients with hematologic malignancies.. For this purpose a new automatic cell processing device (CytoMate, Baxter Oncology) was tested to improve extensive manipulations of these cells. Article Title: Interferon-γ induces combined pyroptotic angiopathy and APOL1 expression in human kidney disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Liu et al. scRNAseq NIH GEO database GEO: GSE135663 Organoid scRNAseq NIH GEO database GEO: GSE230848 NEPTUNE bulk RNAseq NIH GEO database GEO: GSE219185 NEPTUNE snRNAseq NIH GEO database GEO: GSE213030 Experimental models: Cell lines WTC11 iPSCs derived from a Japanese male donor Coriell GM25256 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E8 WTC11 iPSCs PODXL-GFP B Freedman & H Fu Labs, University of Washington HF22-E9 GFP-Tubulin Allen Institute/Coriell AICS-0012 1016SevA iPSCs derived from fibroblasts from a non-African ancestry donor Harvard Stem Cell Institute N/A UM77-2 hESCs J Harder Lab, University of Michigan NIH registration no. 0278 iPSC line BXS0114 (African American Female) ATCC ACS-1028 iPSC line BYS0110 (African American Male) ATCC ACS-1024 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC35 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC36 Primary human adult kidney endothelial cells Y Zheng Lab, University of Washington AKEC37 HUVECs #1 (pooled donors, Lot #0000478982) Lonza CC-2519 HUVECs #2 (pooled donors, Lot #3001900190) Lonza CC-2519 HUVECs #3 (pooled donors, Lot #0000474578) Lonza CC-2519 Oligonucleotides CCACCGGCAGACCGGACTAG IDT HF22 Recombinant DNA pGuide (modified for oligo HF22) Addgene 64711 pCas9_GFP Addgene 44719 Software and algorithms ImageJ 1.54f NIH N/A R Software (R Core Team [2023]) N/A Seurat v4.0 N/A CZ CELLxGENE Chan Zuckerberg Initiative N/A Ingenuity Pathway Analysis (IPA) Qiagen N/A |